Karie01 Karie01
  • 03-11-2018
  • Mathematics
contestada

How do you verify your answer for a logarithm?

Respuesta :

unicorngirl15
unicorngirl15 unicorngirl15
  • 04-11-2018

you plug it right back in!

Answer Link

Otras preguntas

Which two of the following are MAIN ideas from the article? A) Bakeries began delivering bread to supermarkets, saving women time and stress. B) Frank Conrad's
Meatpackers, Inc., enters into a contract with Nevada Ranch for the delivery of a certain number of beef cattle on a set schedule. The ranch delays the first de
can someone help with with this essay ? its a comparison essay about Chaplinsky v. New Hampshire and Cohen v. California case
What characteristics did all three kindgoms have in common?
A spring on a horizontal surface can be stretched and held 0.5 m from its equilibrium position with a force of 60 N. a. How much work is done in stretching the
Conjuguer le verbe « s’amuser » au présent
Nazis took control of _ and Northern France.
Do you think Gore is correct? Explain
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
please help me with this question