noahbrown12 noahbrown12

04-02-2020
Chemistry

contestada

Li2O + H2O = LiOH
If you have 25 grams of Li2O how many grams of LiOH?

Respuesta :

ranissajackson2 ranissajackson2

04-02-2020

2 grams of LiOH.......

Answer Link

Otras preguntas

What’s the missing side?

Regents what was a goal of progressive era reforms such as recall, referendum, and the direct primary?

Which of the following are solutions to the equation below? Check all that apply. x2 - 16 = 0

Which great society program was a comprehensive health insurance program for all senior citizens?

Frozen water (ice) has less density than liquid water. How does this property of water affect life on Earth?

Cell respiration why does a runner breathe hard after finishing a race

all other things being equal,the size of a population will decrease if

If the points (-2, 2), (-4, 4), (2, -2), and (4, -4) are joined to form a straight line, at what point does the line intersect the y-axis

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

PLEASE HELP ASAP what is the correct product of (7x - 3)(7x + 3).49x^2 + 949x^2 - 42x + 9 49x^2 - 949x^2 + 42x + 9