jamistrickland18 jamistrickland18
  • 04-02-2020
  • Mathematics
contestada

What number makes (x+1)(x+2) equal 9

Respuesta :

Аноним Аноним
  • 04-02-2020

Answer: 1 and 5

Step-by-step explanation:

Why I chose 1 and 5 because I thought of adding 1+1 and get 2 then add 5+2 equals 7 then add 2+7 and get 9

Hope this helps!

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
What are the factors of 6x + 24?
solve the simultaneous equation 4x+7y=1 3x+10y=15
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
Please help with Algebra 1
what rule does static electricity follow
testosterone directly affects the