Pinkdraco Pinkdraco

01-04-2020
Biology

contestada

What are the weather conditions in an area of high
pressure?

Respuesta :

emmafinn1300 emmafinn1300

01-04-2020

higher pressure systems usually associate with dryer weather and mostly clear skies with larger diurnal temperature changes due to greater radiation during the night and greater sunshine at daytime.

Answer Link

Otras preguntas

Completa la frase con el mandato correcto. (Complete the sentence with the correct command.) Acabo de limpiar la cocina. Elena, __________ a la tienda para comp

what is the difference in length between a 1 and 1/4 inch button and a 3/8 inch button

Joseph and cleoma, who made the first cajun recording, were husband and wife

What is the value of x?

The number of students in the book club is increasing at a rate of 15% per year. In 2010 there were 9 students in the book club. Find the number of students exp

Simplify the expression: (5a^4b^2)^3(-2b^4)

Thinking about suicide is called _________, and a suicide attempt that is not completed is called __________.

What is the solution to the equation ? n = −1 n = 2 n = 5/3 n = 5/2

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Throughout most of the war, southern forces suffered from a chronic shortage of food and supplies. a. True b. False