victor7922 victor7922
  • 03-09-2020
  • English
contestada

Why did Ponyboy think that maybe his world and Cherry's
weren't so different?

Respuesta :

skylarsmith1246 skylarsmith1246
  • 03-09-2020

Answer:

Ponyboy thinks that maybe his world and Cherry's might not be different because both go through tough times and both watch the same sunset.

Explanation:

Answer Link

Otras preguntas

Given the following list of numbers: 9, 7, 11, 16, 11, 19, 9, 10, 15, 14, 8, 12, 15 What is the Q1?
WILL GIVE BRAINLIEST FOR CORRECT ANSWER!
Aside from direct harm, what secondary issue do invasive species present? They may be able to eat all kinds of native organisms. They may not have any predators
Why might someone decide to lease a home? What types of things are landlords responsible for when renting homes? What types of things should you consider if
A whale is at the surface of the ocean to breathe. What is the whale’s elevation? A:100 B:-100 C:-50 D:0
What two types of governments in Latin America?
PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
what is the value of the expression 2c(c+3)^2 if c=2 5 20
the _____ and ____ systems work together to support the body and enable it to move
How many 2 /3 parts are in 2 wholes? The number of 2 /3 parts in 2 wholes is