Seudónimo Seudónimo
  • 03-11-2016
  • Mathematics
contestada

What is the percent decrease from $16 to $4?

Respuesta :

Аноним Аноним
  • 03-11-2016
75% ..................


Answer Link

Otras preguntas

Factor completely 16x^3−36x
James is interested in the relationship between weather conditions and whether the downtown train runs on time. For a year, James records the weather each day a
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
factor polynomial 4a^2-4a+1
The number 66 is increased to 72. What is the percentage by which the number was increased, to the nearest tenth of a percent?
What does Sampson do (not say) that aggravates Abram and Balthasar?
What type of recording option begins the recording automatically when the decibel level of the input sound goes above a preset level? A. auto input B. auto re
Question 5 options: A high school principal wishes to estimate how well his students are doing in math. Using 40 randomly chosen tests, he finds that 77% of the
two objects with the same mass move with the same speed but in opposite directions. A. Kinetic energies are equal B. Kinetic energies are opposite in magnitude
The figure is made of a retangular prism.what is the volume?