toazn4u toazn4u
  • 03-11-2016
  • Biology
contestada

3 things plants need.

Respuesta :

john123aba john123aba
  • 03-11-2016
Plants need sunlight,water, and good soil.
Mark me brainliest
Answer Link
Аноним Аноним
  • 03-11-2016
Plants need H2O (water), sunlight (light energy), and CO2 (carbon dioxide) in order to undergo photosynthesis. Hope this helps! :)
Answer Link

Otras preguntas

Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
How do you put allele in a sentence
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
Failure to incorporate _______ can easily lead to _______. Would the answer be: citations, plagiarism?
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
what are 2 examples of ionic compound?
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
A generator stores electric current. Explain why you agree or disagree with this statement
Solve the equation -10 + 3x + 5x = -56 ? ??