nemonemo6496 nemonemo6496

01-04-2021
Mathematics

contestada

If you roll a 6-sided die 6times, what is the best prediction possible for the number of times you roll a three

Respuesta :

maxwellS23646 maxwellS23646

01-04-2021

Answer:

You have a 1/6 chance to land on a 3.

Step-by-step explanation:

Answer Link

Otras preguntas

which of the following is an example of a mixture?

Robert wrote a check to pay for his groceries. He thought he had $250 in his checking account but he actually had $200. Determine the percent of error

In the year 2500, five male space colonists and five female space colonists (all unrelated to each other) settle on an uninhabited Earthlike planet in the Andro

Hawaii (12° F)-60South Dakota (-58° F)Enter the difference, in degrees, between the record low temperaturesHawaii and South Dakota.

The shrubs and trees in windbreaks protect soil from erosion by rain water. Please select the best answer from the choices provided T F

18h^3 + 45h^2 - 8h - 20

Which of the following statements describes how to conduct a horizontal analysis? Compare amounts of a recent year to a future year and identify growth trends.

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

which of the following is the best example of a major dispute during the Constitutional Convention

match the correct y=mx+b equation to the graph: pls show work/explanation!