Seudónimo Seudónimo
  • 01-12-2016
  • Mathematics
contestada

what is the missing base 256 = ^4

Respuesta :

bcalle
bcalle bcalle
  • 01-12-2016
4^4 =256 the missing base is4
Answer Link

Otras preguntas

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
What was the most common way for white settlers to travel the Oregon Trail? PLEASE ANSWER IF U KNOW THE CORECT ONE this is literally worth 14 points on my assi
HEYOO PEEPS 1. Ethan Rides his bike up a 20km hill in 2hrs. Ethan rides his bike down the 20km hill in .5 hrs. What is Ethan’s average speed?
Human body cells each have 46 chromosomes in their nuclei. Meiosis is necessary in order to ensure that each gamete produced in the human body has —
What does this excerpt tell you about the narrator?a He does not like gamblers.b He is eager to hear Simon Wheeler's story.c He does not understand Wheeler at a
A 25-N force accelerates a boy on a cart at 0.5 m/s2. What is the mass of the boy and the cart? (Hint: Solve newton’s second law for mass).
The United States wanted a better relationship with the Soviet Union and China because?
what is the vertex of y=x^2+10x+9
What is the square root of 23
Jon took his kayak out for a paddle on the river. As he was exploring a quiet cove, a giant snapping turtle suddenly heaved out of the water right beside him. A