deathdramaqueen deathdramaqueen

01-06-2021
Mathematics

contestada

-3x+10=21 solve for x

Respuesta :

bhadelsimron19 bhadelsimron19

01-06-2021

Answer:

Step-by-step explanation:

-3x+10=21

-3x=21-10

-3x=11

x=11/-3

x=- 11/3

Answer Link

Otras preguntas

What is the new equation 1 when youmultiply by -1?

write a function to describe the following scenario.a garden watering bucket has 3,000 mm of water in it but there is a hole that is leaking 18 mm every minute

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.

The graph of f(x) = 4+ is shown below in blue. This graph in red is a transformation of f(x). Write a function thatdescribes the

1. Predict what will happen when a tape diagram has a large number of squares, some squares are removed, and thenthe same amount of squares are added back on.Bu

Find the arc in bold. Round your answers to 2 decimal places.57°26 mmeters

find the value of the trigonometric ratio. make sure to simplify the fraction if needed. PLEASE HURRY!!

Can someone explain how to answer this problem Write an equation in point-slope form given the following: (1,2); m=7 thanks

Find the area of the polygon. (hint: you need to solve for missing apothem or sides).Also round the area to the nearest whole number

There was a survey taken to see which types of pets people prefer. Out of 11 participents, 5 said they prefer dogs, 4 said they prefer cats, and 3 said they pre