jronspencer2 jronspencer2

01-10-2021
English

contestada

Those who did not want to break away from Britain were called
.

Respuesta :

meloralace21 meloralace21

01-10-2021

Answer:

Loyalists were men and women who refused to fight against Great Britain. About 500,000 colonists were Loyalists.

Explanation:

Answer Link

durlle566 durlle566

01-10-2021

Answer:

They were called Loyalists

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What value is added to both sides of the equation x2 − 2x = 10 in order to solve by completing the square? A. -1 B. -2 C. 1 D. 2

The element with the most stable nucleus and smallest mass per particle is

What is the distance between 407 squared and negative 68 squared

circadian rhythm refers to

What is the distance between points (21, -32) and (-3, -25)?

cody has 7/8 pound of cheese. he uses 1/7 since there are 16 ounces in a pound how much is left

There are 36 ways two dice can land: six ways for the first die and six ways for the second die. in how many of those ways does at least one of the dice show a

We had lunch: sandwiches, potato chips, and iced tea. Carolyn and her mother talked mostly about neighbors and the congregation at the Japanese Methodist Church

Toco el piano _______________ hace dos meses. desde se les por