malayalatham9434 malayalatham9434

01-03-2022
Physics

contestada

What effect does increasing pressure have on gas particles.

Respuesta :

Amandamackenzie905 Amandamackenzie905

01-03-2022

Answer:

they go BOOM i seen a gas station do it

Explanation:

Answer Link

Otras preguntas

According to Alain Locke, what are TWO changes that have occurred in the 1920's for African Americans living in the United States?

Use the sliders on the interactive to determine the shape of the conic when A and C equal specific values. AR+ Cy? +x+y - 9 = 0 A= 1, C = 5, Conic Type: A=-2, C

Henry bought a basketball that was on sale for $12. It was 40% off. What was the original price of the basketball? Please Help.

9.7 x 0.006 divided by 0.825

What will happen if you increase the electric current that is flowing through an electromagnet? A. The magnet will become weaker. B. The poles of the magnet wil

5-Escriba el tipo de narrador que se presenta en los siguientes textos:Texto 1- Me encontraba recostado en unas redes en la enramada de Felipe Veda. Eran las 3:

show me a picture of 3 * 5 * 2

Please help me someone?

If the “Final Solution” was to murder all Jews, why do you think the Nazi’s set up concentration camps in addition to death camps?

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU