kalipark8580 kalipark8580
  • 03-10-2017
  • Mathematics
contestada

Functions are all one to one. find and equation for f inverse of x, and then verify that your equation is correct by showing that

Respuesta :

aereadnos aereadnos
  • 03-10-2017
to find the inverse, isolate x (move everything over to the y side except x and change the variable names (from x to y and from y to x)
Answer Link

Otras preguntas

Express the perimeter of the triangle as a polynomial. 8x+2 5x-4 9x+3
Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!
an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.
What is the difference between "Herr" and "Herrn"?
Which of the following was not an accomplishment of the emperor Trajanlegalized Christianity       built bridges, aqueducts and harbors       reduced taxes
What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims
what is the most common type of vegetation throughout Latin America
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s