Cheveler
Cheveler Cheveler
  • 03-11-2017
  • Biology
contestada

How does viscosity determine what type of eruption you will get out of a volcano?

Respuesta :

erainabrown
erainabrown erainabrown
  • 03-11-2017
The viscosity of magma or lava will determine whether or not if the explosive is gonna be explosive or quiet. The higher the visocosity magma can cause explosive eruptions however the lower the viscosity magma can flow more freely.
Answer Link

Otras preguntas

Why was wilson not able to finish his speaking tour
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
does radiation need a phase of matter to travel with?
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
what is the percent change from 70 to 56?
In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front
Fossils are most commonly found in which type of rock?
explain, in terms of atomic structure, why group 18 elements on the periodic table rarely form compounds
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front