tierann1186 tierann1186
  • 01-05-2018
  • Business
contestada

Shared values among employees are the glue of successful management
a. True
b. False

Respuesta :

MrsTriplet MrsTriplet
  • 10-05-2018
Shared values among employees are the glue of successful management. True. In the workplace, it is important for employees to share similar values about their work and the company to achieve more. Leaders try and align their ethics and virtues with each other as it pertains to work and then pass the same feelings down to their employees that they manage. 
Answer Link

Otras preguntas

In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How do I do trebuchet calculations????? Help me please
how can you write 0.45 as fraction and a percentage ,please show work
Tu as quels cours le jeudi matin?
What is the range of function of y-1=(x+3)^2
what is the most common type of vegetation throughout Latin America
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left
What is the domain of the relation {(2, 8), (0, 8), (–1, 5), (–1, 3), (–2, 3)}?